Review



antibody anti-human homer (rabbit polyclonal)  (Synaptic Systems)


Bioz Verified Symbol Synaptic Systems is a verified supplier
Bioz Manufacturer Symbol Synaptic Systems manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Synaptic Systems antibody anti-human homer (rabbit polyclonal)

    Antibody Anti Human Homer (Rabbit Polyclonal), supplied by Synaptic Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/antibody+anti-human+homer+(rabbit+polyclonal)/anti++human+homer++rabbit+polyclonal+/pmc10121225-8-2-7
    Average 90 stars, based on 1 article reviews
    antibody anti-human homer (rabbit polyclonal) - by Bioz Stars, 2026-09
    90/100 stars

    Images

    1) Product Images from "High-content synaptic phenotyping in human cellular models reveals a role for BET proteins in synapse assembly"

    Article Title: High-content synaptic phenotyping in human cellular models reveals a role for BET proteins in synapse assembly

    Journal: eLife

    doi: 10.7554/eLife.80168


    Figure Legend Snippet:

    Techniques Used: Transfection, Construct, Control, Recombinant, Plasmid Preparation, Sequencing, Lysis, Drug discovery, Software

    Related Articles

    Western Blot:

    Article Title: High-content synaptic phenotyping in human cellular models reveals a role for BET proteins in synapse assembly
    Article Snippet: antibody , Anti-human HOMER (Rabbit polyclonal) , Synaptic Systems , Cat#160003 RRID: AB_887730 , WB (1:500).

    Article Title: High-content synaptic phenotyping in human cellular models reveals a role for BET proteins in synapse assembly
    Article Snippet: DOI: https://doi.org/10.7554/eLife.80168 19 of 31 Reagent type (species) or resource Designation Source or reference Identifiers Additional information antibody Anti- human SYNAPSIN1 (Rabbit polyclonal) Millipore Cat#AB1543 RRID: AB_2200400 IF (1:1000) WB (1:1000) antibody Anti- human MAP2 (Chicken polyclonal) Abcam Cat#ab5392 RRID: AB_2138153 IF (1:1000) antibody Anti- human SYNAPTOPHYSIN (Mouse monoclonal) Cell Signaling Technology Cat#9020 RRID: AB_2631095 IF (1:500) antibody Anti- human PSD95 (Mouse monoclonal) Thermo Fisher Scientific Cat#MA1- 046 RRID: AB_2092361 IF (1:500) antibody Anti- human GAPDH (Mouse monoclonal) Millipore Cat#MAB374 RRID: AB_2107445 WB (1:1000) antibody Anti- human HOMER (Rabbit polyclonal) Synaptic Systems Cat#160003 RRID: AB_887730 WB (1:500) antibody Anti- human BAIAP2 (Rabbit polyclonal) Thermo Fisher Scientific Cat#PA5- 30386 RRID: AB_2547860 WB (1:500) antibody Anti- human COFILIN Abcam Cat#ab42824 RRID: AB_879739 WB (1:1000) recombinant DNA reagent pAAVS1- iNGN2- Zeo (plasmid) This study sequence- based reagent Forward NGN2 This study PCR primers AGGAAATGGGGGTGTGTCAC sequence- based reagent Reverse NGN2 This study PCR primers GAGCTCCTCTGGCGATTCTC commercial assay or kit DNeasy Blood and tissue kit Qiagen Cat#695004 commercial assay or kit RLTplus Lysis buffer Qiagen Cat#1053393 commercial assay or kit RNeasy micro/mini kit Qiagen Cat#74034 chemical compound, drug Geneticin Life Technologies Cat#10131035 50 μg.mL–1 chemical compound, drug SB431542 Tocris Cat#1614 10 μM; 5 μM chemical compound, drug XAV939 Stemgent Cat#04–00046 2 μM; 1 μM chemical compound, drug LDN- 193189 Stemgent Cat#04–0074 100 nM; 50 nM chemical compound, drug Doxycycline hyclate SIgma Cat#D9891 2 μg.mL–1 chemical compound, drug Y27632 Stemgent Cat#04–0012 5 mM chemical compound, drug Zeocin Invitrogen Cat#46–059 1 μg.mL–1 chemical compound, drug BDNF R&D Systems Cat#248- BD/CF 10 ng.mL–1 chemical compound, drug CTNF R&D Systems Cat#257- NT- CF 10 ng.mL–1 chemical compound, drug GDNF R&D Systems Cat#212- GD/CF 10 ng.mL–1 chemical compound, drug Floxuridine Sigma- Aldrich Cat#F0503- 100MG 10 μg.mL–1 Continued on next page Continued Berryer et al. eLife 2023;12:e80168.

    Article Title: Post-synaptic Release of the Neuronal Tissue-Type Plasminogen Activator (tPA)
    Article Snippet: The following primary antibodies were used for immunocytochemistry: mouse monoclonal anti-HaloTag® (dilution 1:1,000; Promega; G9211) rabbit anti-tPA polyclonal antibody (dilution 1:1 500; generous gift from R. Lijnen, Leuven), chicken anti-Microtubule-associated protein 2 (MAP2) polyclonal antibody (dilution 1:8 000; Abcam, Cambridge, UK; ab5392), rabbit anti-tau polyclonal antibody (dilution 1:500; Abcam; ab64193), guinea pig anti-synapsin polyclonal antibody (dilution 1:500; Synaptic System; 106 004) and rabbit anti-homer-1C polyclonal antibody (dilution 1:500; Synaptic System; 160 003).

    Recombinant:

    Article Title: High-content synaptic phenotyping in human cellular models reveals a role for BET proteins in synapse assembly
    Article Snippet: antibody , Anti-human HOMER (Rabbit polyclonal) , Synaptic Systems , Cat#160003 RRID: AB_887730 , WB (1:500).

    Article Title: High-content synaptic phenotyping in human cellular models reveals a role for BET proteins in synapse assembly
    Article Snippet: DOI: https://doi.org/10.7554/eLife.80168 19 of 31 Reagent type (species) or resource Designation Source or reference Identifiers Additional information antibody Anti- human SYNAPSIN1 (Rabbit polyclonal) Millipore Cat#AB1543 RRID: AB_2200400 IF (1:1000) WB (1:1000) antibody Anti- human MAP2 (Chicken polyclonal) Abcam Cat#ab5392 RRID: AB_2138153 IF (1:1000) antibody Anti- human SYNAPTOPHYSIN (Mouse monoclonal) Cell Signaling Technology Cat#9020 RRID: AB_2631095 IF (1:500) antibody Anti- human PSD95 (Mouse monoclonal) Thermo Fisher Scientific Cat#MA1- 046 RRID: AB_2092361 IF (1:500) antibody Anti- human GAPDH (Mouse monoclonal) Millipore Cat#MAB374 RRID: AB_2107445 WB (1:1000) antibody Anti- human HOMER (Rabbit polyclonal) Synaptic Systems Cat#160003 RRID: AB_887730 WB (1:500) antibody Anti- human BAIAP2 (Rabbit polyclonal) Thermo Fisher Scientific Cat#PA5- 30386 RRID: AB_2547860 WB (1:500) antibody Anti- human COFILIN Abcam Cat#ab42824 RRID: AB_879739 WB (1:1000) recombinant DNA reagent pAAVS1- iNGN2- Zeo (plasmid) This study sequence- based reagent Forward NGN2 This study PCR primers AGGAAATGGGGGTGTGTCAC sequence- based reagent Reverse NGN2 This study PCR primers GAGCTCCTCTGGCGATTCTC commercial assay or kit DNeasy Blood and tissue kit Qiagen Cat#695004 commercial assay or kit RLTplus Lysis buffer Qiagen Cat#1053393 commercial assay or kit RNeasy micro/mini kit Qiagen Cat#74034 chemical compound, drug Geneticin Life Technologies Cat#10131035 50 μg.mL–1 chemical compound, drug SB431542 Tocris Cat#1614 10 μM; 5 μM chemical compound, drug XAV939 Stemgent Cat#04–00046 2 μM; 1 μM chemical compound, drug LDN- 193189 Stemgent Cat#04–0074 100 nM; 50 nM chemical compound, drug Doxycycline hyclate SIgma Cat#D9891 2 μg.mL–1 chemical compound, drug Y27632 Stemgent Cat#04–0012 5 mM chemical compound, drug Zeocin Invitrogen Cat#46–059 1 μg.mL–1 chemical compound, drug BDNF R&D Systems Cat#248- BD/CF 10 ng.mL–1 chemical compound, drug CTNF R&D Systems Cat#257- NT- CF 10 ng.mL–1 chemical compound, drug GDNF R&D Systems Cat#212- GD/CF 10 ng.mL–1 chemical compound, drug Floxuridine Sigma- Aldrich Cat#F0503- 100MG 10 μg.mL–1 Continued on next page Continued Berryer et al. eLife 2023;12:e80168.

    Article Title: Post-synaptic Release of the Neuronal Tissue-Type Plasminogen Activator (tPA)
    Article Snippet: The following primary antibodies were used for immunocytochemistry: mouse monoclonal anti-HaloTag® (dilution 1:1,000; Promega; G9211) rabbit anti-tPA polyclonal antibody (dilution 1:1 500; generous gift from R. Lijnen, Leuven), chicken anti-Microtubule-associated protein 2 (MAP2) polyclonal antibody (dilution 1:8 000; Abcam, Cambridge, UK; ab5392), rabbit anti-tau polyclonal antibody (dilution 1:500; Abcam; ab64193), guinea pig anti-synapsin polyclonal antibody (dilution 1:500; Synaptic System; 106 004) and rabbit anti-homer-1C polyclonal antibody (dilution 1:500; Synaptic System; 160 003).

    Plasmid Preparation:

    Article Title: High-content synaptic phenotyping in human cellular models reveals a role for BET proteins in synapse assembly
    Article Snippet: antibody , Anti-human HOMER (Rabbit polyclonal) , Synaptic Systems , Cat#160003 RRID: AB_887730 , WB (1:500).

    Article Title: High-content synaptic phenotyping in human cellular models reveals a role for BET proteins in synapse assembly
    Article Snippet: DOI: https://doi.org/10.7554/eLife.80168 19 of 31 Reagent type (species) or resource Designation Source or reference Identifiers Additional information antibody Anti- human SYNAPSIN1 (Rabbit polyclonal) Millipore Cat#AB1543 RRID: AB_2200400 IF (1:1000) WB (1:1000) antibody Anti- human MAP2 (Chicken polyclonal) Abcam Cat#ab5392 RRID: AB_2138153 IF (1:1000) antibody Anti- human SYNAPTOPHYSIN (Mouse monoclonal) Cell Signaling Technology Cat#9020 RRID: AB_2631095 IF (1:500) antibody Anti- human PSD95 (Mouse monoclonal) Thermo Fisher Scientific Cat#MA1- 046 RRID: AB_2092361 IF (1:500) antibody Anti- human GAPDH (Mouse monoclonal) Millipore Cat#MAB374 RRID: AB_2107445 WB (1:1000) antibody Anti- human HOMER (Rabbit polyclonal) Synaptic Systems Cat#160003 RRID: AB_887730 WB (1:500) antibody Anti- human BAIAP2 (Rabbit polyclonal) Thermo Fisher Scientific Cat#PA5- 30386 RRID: AB_2547860 WB (1:500) antibody Anti- human COFILIN Abcam Cat#ab42824 RRID: AB_879739 WB (1:1000) recombinant DNA reagent pAAVS1- iNGN2- Zeo (plasmid) This study sequence- based reagent Forward NGN2 This study PCR primers AGGAAATGGGGGTGTGTCAC sequence- based reagent Reverse NGN2 This study PCR primers GAGCTCCTCTGGCGATTCTC commercial assay or kit DNeasy Blood and tissue kit Qiagen Cat#695004 commercial assay or kit RLTplus Lysis buffer Qiagen Cat#1053393 commercial assay or kit RNeasy micro/mini kit Qiagen Cat#74034 chemical compound, drug Geneticin Life Technologies Cat#10131035 50 μg.mL–1 chemical compound, drug SB431542 Tocris Cat#1614 10 μM; 5 μM chemical compound, drug XAV939 Stemgent Cat#04–00046 2 μM; 1 μM chemical compound, drug LDN- 193189 Stemgent Cat#04–0074 100 nM; 50 nM chemical compound, drug Doxycycline hyclate SIgma Cat#D9891 2 μg.mL–1 chemical compound, drug Y27632 Stemgent Cat#04–0012 5 mM chemical compound, drug Zeocin Invitrogen Cat#46–059 1 μg.mL–1 chemical compound, drug BDNF R&D Systems Cat#248- BD/CF 10 ng.mL–1 chemical compound, drug CTNF R&D Systems Cat#257- NT- CF 10 ng.mL–1 chemical compound, drug GDNF R&D Systems Cat#212- GD/CF 10 ng.mL–1 chemical compound, drug Floxuridine Sigma- Aldrich Cat#F0503- 100MG 10 μg.mL–1 Continued on next page Continued Berryer et al. eLife 2023;12:e80168.

    Article Title: Post-synaptic Release of the Neuronal Tissue-Type Plasminogen Activator (tPA)
    Article Snippet: The following primary antibodies were used for immunocytochemistry: mouse monoclonal anti-HaloTag® (dilution 1:1,000; Promega; G9211) rabbit anti-tPA polyclonal antibody (dilution 1:1 500; generous gift from R. Lijnen, Leuven), chicken anti-Microtubule-associated protein 2 (MAP2) polyclonal antibody (dilution 1:8 000; Abcam, Cambridge, UK; ab5392), rabbit anti-tau polyclonal antibody (dilution 1:500; Abcam; ab64193), guinea pig anti-synapsin polyclonal antibody (dilution 1:500; Synaptic System; 106 004) and rabbit anti-homer-1C polyclonal antibody (dilution 1:500; Synaptic System; 160 003).

    Sequencing:

    Article Title: High-content synaptic phenotyping in human cellular models reveals a role for BET proteins in synapse assembly
    Article Snippet: antibody , Anti-human HOMER (Rabbit polyclonal) , Synaptic Systems , Cat#160003 RRID: AB_887730 , WB (1:500).

    Article Title: High-content synaptic phenotyping in human cellular models reveals a role for BET proteins in synapse assembly
    Article Snippet: DOI: https://doi.org/10.7554/eLife.80168 19 of 31 Reagent type (species) or resource Designation Source or reference Identifiers Additional information antibody Anti- human SYNAPSIN1 (Rabbit polyclonal) Millipore Cat#AB1543 RRID: AB_2200400 IF (1:1000) WB (1:1000) antibody Anti- human MAP2 (Chicken polyclonal) Abcam Cat#ab5392 RRID: AB_2138153 IF (1:1000) antibody Anti- human SYNAPTOPHYSIN (Mouse monoclonal) Cell Signaling Technology Cat#9020 RRID: AB_2631095 IF (1:500) antibody Anti- human PSD95 (Mouse monoclonal) Thermo Fisher Scientific Cat#MA1- 046 RRID: AB_2092361 IF (1:500) antibody Anti- human GAPDH (Mouse monoclonal) Millipore Cat#MAB374 RRID: AB_2107445 WB (1:1000) antibody Anti- human HOMER (Rabbit polyclonal) Synaptic Systems Cat#160003 RRID: AB_887730 WB (1:500) antibody Anti- human BAIAP2 (Rabbit polyclonal) Thermo Fisher Scientific Cat#PA5- 30386 RRID: AB_2547860 WB (1:500) antibody Anti- human COFILIN Abcam Cat#ab42824 RRID: AB_879739 WB (1:1000) recombinant DNA reagent pAAVS1- iNGN2- Zeo (plasmid) This study sequence- based reagent Forward NGN2 This study PCR primers AGGAAATGGGGGTGTGTCAC sequence- based reagent Reverse NGN2 This study PCR primers GAGCTCCTCTGGCGATTCTC commercial assay or kit DNeasy Blood and tissue kit Qiagen Cat#695004 commercial assay or kit RLTplus Lysis buffer Qiagen Cat#1053393 commercial assay or kit RNeasy micro/mini kit Qiagen Cat#74034 chemical compound, drug Geneticin Life Technologies Cat#10131035 50 μg.mL–1 chemical compound, drug SB431542 Tocris Cat#1614 10 μM; 5 μM chemical compound, drug XAV939 Stemgent Cat#04–00046 2 μM; 1 μM chemical compound, drug LDN- 193189 Stemgent Cat#04–0074 100 nM; 50 nM chemical compound, drug Doxycycline hyclate SIgma Cat#D9891 2 μg.mL–1 chemical compound, drug Y27632 Stemgent Cat#04–0012 5 mM chemical compound, drug Zeocin Invitrogen Cat#46–059 1 μg.mL–1 chemical compound, drug BDNF R&D Systems Cat#248- BD/CF 10 ng.mL–1 chemical compound, drug CTNF R&D Systems Cat#257- NT- CF 10 ng.mL–1 chemical compound, drug GDNF R&D Systems Cat#212- GD/CF 10 ng.mL–1 chemical compound, drug Floxuridine Sigma- Aldrich Cat#F0503- 100MG 10 μg.mL–1 Continued on next page Continued Berryer et al. eLife 2023;12:e80168.

    Article Title: Post-synaptic Release of the Neuronal Tissue-Type Plasminogen Activator (tPA)
    Article Snippet: The following primary antibodies were used for immunocytochemistry: mouse monoclonal anti-HaloTag® (dilution 1:1,000; Promega; G9211) rabbit anti-tPA polyclonal antibody (dilution 1:1 500; generous gift from R. Lijnen, Leuven), chicken anti-Microtubule-associated protein 2 (MAP2) polyclonal antibody (dilution 1:8 000; Abcam, Cambridge, UK; ab5392), rabbit anti-tau polyclonal antibody (dilution 1:500; Abcam; ab64193), guinea pig anti-synapsin polyclonal antibody (dilution 1:500; Synaptic System; 106 004) and rabbit anti-homer-1C polyclonal antibody (dilution 1:500; Synaptic System; 160 003).

    Polymerase Chain Reaction:

    Article Title: High-content synaptic phenotyping in human cellular models reveals a role for BET proteins in synapse assembly
    Article Snippet: antibody , Anti-human HOMER (Rabbit polyclonal) , Synaptic Systems , Cat#160003 RRID: AB_887730 , WB (1:500).

    Article Title: High-content synaptic phenotyping in human cellular models reveals a role for BET proteins in synapse assembly
    Article Snippet: DOI: https://doi.org/10.7554/eLife.80168 19 of 31 Reagent type (species) or resource Designation Source or reference Identifiers Additional information antibody Anti- human SYNAPSIN1 (Rabbit polyclonal) Millipore Cat#AB1543 RRID: AB_2200400 IF (1:1000) WB (1:1000) antibody Anti- human MAP2 (Chicken polyclonal) Abcam Cat#ab5392 RRID: AB_2138153 IF (1:1000) antibody Anti- human SYNAPTOPHYSIN (Mouse monoclonal) Cell Signaling Technology Cat#9020 RRID: AB_2631095 IF (1:500) antibody Anti- human PSD95 (Mouse monoclonal) Thermo Fisher Scientific Cat#MA1- 046 RRID: AB_2092361 IF (1:500) antibody Anti- human GAPDH (Mouse monoclonal) Millipore Cat#MAB374 RRID: AB_2107445 WB (1:1000) antibody Anti- human HOMER (Rabbit polyclonal) Synaptic Systems Cat#160003 RRID: AB_887730 WB (1:500) antibody Anti- human BAIAP2 (Rabbit polyclonal) Thermo Fisher Scientific Cat#PA5- 30386 RRID: AB_2547860 WB (1:500) antibody Anti- human COFILIN Abcam Cat#ab42824 RRID: AB_879739 WB (1:1000) recombinant DNA reagent pAAVS1- iNGN2- Zeo (plasmid) This study sequence- based reagent Forward NGN2 This study PCR primers AGGAAATGGGGGTGTGTCAC sequence- based reagent Reverse NGN2 This study PCR primers GAGCTCCTCTGGCGATTCTC commercial assay or kit DNeasy Blood and tissue kit Qiagen Cat#695004 commercial assay or kit RLTplus Lysis buffer Qiagen Cat#1053393 commercial assay or kit RNeasy micro/mini kit Qiagen Cat#74034 chemical compound, drug Geneticin Life Technologies Cat#10131035 50 μg.mL–1 chemical compound, drug SB431542 Tocris Cat#1614 10 μM; 5 μM chemical compound, drug XAV939 Stemgent Cat#04–00046 2 μM; 1 μM chemical compound, drug LDN- 193189 Stemgent Cat#04–0074 100 nM; 50 nM chemical compound, drug Doxycycline hyclate SIgma Cat#D9891 2 μg.mL–1 chemical compound, drug Y27632 Stemgent Cat#04–0012 5 mM chemical compound, drug Zeocin Invitrogen Cat#46–059 1 μg.mL–1 chemical compound, drug BDNF R&D Systems Cat#248- BD/CF 10 ng.mL–1 chemical compound, drug CTNF R&D Systems Cat#257- NT- CF 10 ng.mL–1 chemical compound, drug GDNF R&D Systems Cat#212- GD/CF 10 ng.mL–1 chemical compound, drug Floxuridine Sigma- Aldrich Cat#F0503- 100MG 10 μg.mL–1 Continued on next page Continued Berryer et al. eLife 2023;12:e80168.

    Article Title: Post-synaptic Release of the Neuronal Tissue-Type Plasminogen Activator (tPA)
    Article Snippet: The following primary antibodies were used for immunocytochemistry: mouse monoclonal anti-HaloTag® (dilution 1:1,000; Promega; G9211) rabbit anti-tPA polyclonal antibody (dilution 1:1 500; generous gift from R. Lijnen, Leuven), chicken anti-Microtubule-associated protein 2 (MAP2) polyclonal antibody (dilution 1:8 000; Abcam, Cambridge, UK; ab5392), rabbit anti-tau polyclonal antibody (dilution 1:500; Abcam; ab64193), guinea pig anti-synapsin polyclonal antibody (dilution 1:500; Synaptic System; 106 004) and rabbit anti-homer-1C polyclonal antibody (dilution 1:500; Synaptic System; 160 003).

    Lysis:

    Article Title: High-content synaptic phenotyping in human cellular models reveals a role for BET proteins in synapse assembly
    Article Snippet: antibody , Anti-human HOMER (Rabbit polyclonal) , Synaptic Systems , Cat#160003 RRID: AB_887730 , WB (1:500).

    Article Title: High-content synaptic phenotyping in human cellular models reveals a role for BET proteins in synapse assembly
    Article Snippet: DOI: https://doi.org/10.7554/eLife.80168 19 of 31 Reagent type (species) or resource Designation Source or reference Identifiers Additional information antibody Anti- human SYNAPSIN1 (Rabbit polyclonal) Millipore Cat#AB1543 RRID: AB_2200400 IF (1:1000) WB (1:1000) antibody Anti- human MAP2 (Chicken polyclonal) Abcam Cat#ab5392 RRID: AB_2138153 IF (1:1000) antibody Anti- human SYNAPTOPHYSIN (Mouse monoclonal) Cell Signaling Technology Cat#9020 RRID: AB_2631095 IF (1:500) antibody Anti- human PSD95 (Mouse monoclonal) Thermo Fisher Scientific Cat#MA1- 046 RRID: AB_2092361 IF (1:500) antibody Anti- human GAPDH (Mouse monoclonal) Millipore Cat#MAB374 RRID: AB_2107445 WB (1:1000) antibody Anti- human HOMER (Rabbit polyclonal) Synaptic Systems Cat#160003 RRID: AB_887730 WB (1:500) antibody Anti- human BAIAP2 (Rabbit polyclonal) Thermo Fisher Scientific Cat#PA5- 30386 RRID: AB_2547860 WB (1:500) antibody Anti- human COFILIN Abcam Cat#ab42824 RRID: AB_879739 WB (1:1000) recombinant DNA reagent pAAVS1- iNGN2- Zeo (plasmid) This study sequence- based reagent Forward NGN2 This study PCR primers AGGAAATGGGGGTGTGTCAC sequence- based reagent Reverse NGN2 This study PCR primers GAGCTCCTCTGGCGATTCTC commercial assay or kit DNeasy Blood and tissue kit Qiagen Cat#695004 commercial assay or kit RLTplus Lysis buffer Qiagen Cat#1053393 commercial assay or kit RNeasy micro/mini kit Qiagen Cat#74034 chemical compound, drug Geneticin Life Technologies Cat#10131035 50 μg.mL–1 chemical compound, drug SB431542 Tocris Cat#1614 10 μM; 5 μM chemical compound, drug XAV939 Stemgent Cat#04–00046 2 μM; 1 μM chemical compound, drug LDN- 193189 Stemgent Cat#04–0074 100 nM; 50 nM chemical compound, drug Doxycycline hyclate SIgma Cat#D9891 2 μg.mL–1 chemical compound, drug Y27632 Stemgent Cat#04–0012 5 mM chemical compound, drug Zeocin Invitrogen Cat#46–059 1 μg.mL–1 chemical compound, drug BDNF R&D Systems Cat#248- BD/CF 10 ng.mL–1 chemical compound, drug CTNF R&D Systems Cat#257- NT- CF 10 ng.mL–1 chemical compound, drug GDNF R&D Systems Cat#212- GD/CF 10 ng.mL–1 chemical compound, drug Floxuridine Sigma- Aldrich Cat#F0503- 100MG 10 μg.mL–1 Continued on next page Continued Berryer et al. eLife 2023;12:e80168.

    Article Title: Post-synaptic Release of the Neuronal Tissue-Type Plasminogen Activator (tPA)
    Article Snippet: The following primary antibodies were used for immunocytochemistry: mouse monoclonal anti-HaloTag® (dilution 1:1,000; Promega; G9211) rabbit anti-tPA polyclonal antibody (dilution 1:1 500; generous gift from R. Lijnen, Leuven), chicken anti-Microtubule-associated protein 2 (MAP2) polyclonal antibody (dilution 1:8 000; Abcam, Cambridge, UK; ab5392), rabbit anti-tau polyclonal antibody (dilution 1:500; Abcam; ab64193), guinea pig anti-synapsin polyclonal antibody (dilution 1:500; Synaptic System; 106 004) and rabbit anti-homer-1C polyclonal antibody (dilution 1:500; Synaptic System; 160 003).

    Transfection:

    Article Title: High-content synaptic phenotyping in human cellular models reveals a role for BET proteins in synapse assembly
    Article Snippet: antibody , Anti-human HOMER (Rabbit polyclonal) , Synaptic Systems , Cat#160003 RRID: AB_887730 , WB (1:500).

    Article Title: High-content synaptic phenotyping in human cellular models reveals a role for BET proteins in synapse assembly
    Article Snippet: DOI: https://doi.org/10.7554/eLife.80168 19 of 31 Reagent type (species) or resource Designation Source or reference Identifiers Additional information antibody Anti- human SYNAPSIN1 (Rabbit polyclonal) Millipore Cat#AB1543 RRID: AB_2200400 IF (1:1000) WB (1:1000) antibody Anti- human MAP2 (Chicken polyclonal) Abcam Cat#ab5392 RRID: AB_2138153 IF (1:1000) antibody Anti- human SYNAPTOPHYSIN (Mouse monoclonal) Cell Signaling Technology Cat#9020 RRID: AB_2631095 IF (1:500) antibody Anti- human PSD95 (Mouse monoclonal) Thermo Fisher Scientific Cat#MA1- 046 RRID: AB_2092361 IF (1:500) antibody Anti- human GAPDH (Mouse monoclonal) Millipore Cat#MAB374 RRID: AB_2107445 WB (1:1000) antibody Anti- human HOMER (Rabbit polyclonal) Synaptic Systems Cat#160003 RRID: AB_887730 WB (1:500) antibody Anti- human BAIAP2 (Rabbit polyclonal) Thermo Fisher Scientific Cat#PA5- 30386 RRID: AB_2547860 WB (1:500) antibody Anti- human COFILIN Abcam Cat#ab42824 RRID: AB_879739 WB (1:1000) recombinant DNA reagent pAAVS1- iNGN2- Zeo (plasmid) This study sequence- based reagent Forward NGN2 This study PCR primers AGGAAATGGGGGTGTGTCAC sequence- based reagent Reverse NGN2 This study PCR primers GAGCTCCTCTGGCGATTCTC commercial assay or kit DNeasy Blood and tissue kit Qiagen Cat#695004 commercial assay or kit RLTplus Lysis buffer Qiagen Cat#1053393 commercial assay or kit RNeasy micro/mini kit Qiagen Cat#74034 chemical compound, drug Geneticin Life Technologies Cat#10131035 50 μg.mL–1 chemical compound, drug SB431542 Tocris Cat#1614 10 μM; 5 μM chemical compound, drug XAV939 Stemgent Cat#04–00046 2 μM; 1 μM chemical compound, drug LDN- 193189 Stemgent Cat#04–0074 100 nM; 50 nM chemical compound, drug Doxycycline hyclate SIgma Cat#D9891 2 μg.mL–1 chemical compound, drug Y27632 Stemgent Cat#04–0012 5 mM chemical compound, drug Zeocin Invitrogen Cat#46–059 1 μg.mL–1 chemical compound, drug BDNF R&D Systems Cat#248- BD/CF 10 ng.mL–1 chemical compound, drug CTNF R&D Systems Cat#257- NT- CF 10 ng.mL–1 chemical compound, drug GDNF R&D Systems Cat#212- GD/CF 10 ng.mL–1 chemical compound, drug Floxuridine Sigma- Aldrich Cat#F0503- 100MG 10 μg.mL–1 Continued on next page Continued Berryer et al. eLife 2023;12:e80168.

    Article Title: Post-synaptic Release of the Neuronal Tissue-Type Plasminogen Activator (tPA)
    Article Snippet: The following primary antibodies were used for immunocytochemistry: mouse monoclonal anti-HaloTag® (dilution 1:1,000; Promega; G9211) rabbit anti-tPA polyclonal antibody (dilution 1:1 500; generous gift from R. Lijnen, Leuven), chicken anti-Microtubule-associated protein 2 (MAP2) polyclonal antibody (dilution 1:8 000; Abcam, Cambridge, UK; ab5392), rabbit anti-tau polyclonal antibody (dilution 1:500; Abcam; ab64193), guinea pig anti-synapsin polyclonal antibody (dilution 1:500; Synaptic System; 106 004) and rabbit anti-homer-1C polyclonal antibody (dilution 1:500; Synaptic System; 160 003).

    Construct:

    Article Title: High-content synaptic phenotyping in human cellular models reveals a role for BET proteins in synapse assembly
    Article Snippet: antibody , Anti-human HOMER (Rabbit polyclonal) , Synaptic Systems , Cat#160003 RRID: AB_887730 , WB (1:500).

    Article Title: High-content synaptic phenotyping in human cellular models reveals a role for BET proteins in synapse assembly
    Article Snippet: DOI: https://doi.org/10.7554/eLife.80168 19 of 31 Reagent type (species) or resource Designation Source or reference Identifiers Additional information antibody Anti- human SYNAPSIN1 (Rabbit polyclonal) Millipore Cat#AB1543 RRID: AB_2200400 IF (1:1000) WB (1:1000) antibody Anti- human MAP2 (Chicken polyclonal) Abcam Cat#ab5392 RRID: AB_2138153 IF (1:1000) antibody Anti- human SYNAPTOPHYSIN (Mouse monoclonal) Cell Signaling Technology Cat#9020 RRID: AB_2631095 IF (1:500) antibody Anti- human PSD95 (Mouse monoclonal) Thermo Fisher Scientific Cat#MA1- 046 RRID: AB_2092361 IF (1:500) antibody Anti- human GAPDH (Mouse monoclonal) Millipore Cat#MAB374 RRID: AB_2107445 WB (1:1000) antibody Anti- human HOMER (Rabbit polyclonal) Synaptic Systems Cat#160003 RRID: AB_887730 WB (1:500) antibody Anti- human BAIAP2 (Rabbit polyclonal) Thermo Fisher Scientific Cat#PA5- 30386 RRID: AB_2547860 WB (1:500) antibody Anti- human COFILIN Abcam Cat#ab42824 RRID: AB_879739 WB (1:1000) recombinant DNA reagent pAAVS1- iNGN2- Zeo (plasmid) This study sequence- based reagent Forward NGN2 This study PCR primers AGGAAATGGGGGTGTGTCAC sequence- based reagent Reverse NGN2 This study PCR primers GAGCTCCTCTGGCGATTCTC commercial assay or kit DNeasy Blood and tissue kit Qiagen Cat#695004 commercial assay or kit RLTplus Lysis buffer Qiagen Cat#1053393 commercial assay or kit RNeasy micro/mini kit Qiagen Cat#74034 chemical compound, drug Geneticin Life Technologies Cat#10131035 50 μg.mL–1 chemical compound, drug SB431542 Tocris Cat#1614 10 μM; 5 μM chemical compound, drug XAV939 Stemgent Cat#04–00046 2 μM; 1 μM chemical compound, drug LDN- 193189 Stemgent Cat#04–0074 100 nM; 50 nM chemical compound, drug Doxycycline hyclate SIgma Cat#D9891 2 μg.mL–1 chemical compound, drug Y27632 Stemgent Cat#04–0012 5 mM chemical compound, drug Zeocin Invitrogen Cat#46–059 1 μg.mL–1 chemical compound, drug BDNF R&D Systems Cat#248- BD/CF 10 ng.mL–1 chemical compound, drug CTNF R&D Systems Cat#257- NT- CF 10 ng.mL–1 chemical compound, drug GDNF R&D Systems Cat#212- GD/CF 10 ng.mL–1 chemical compound, drug Floxuridine Sigma- Aldrich Cat#F0503- 100MG 10 μg.mL–1 Continued on next page Continued Berryer et al. eLife 2023;12:e80168.

    Article Title: Post-synaptic Release of the Neuronal Tissue-Type Plasminogen Activator (tPA)
    Article Snippet: The following primary antibodies were used for immunocytochemistry: mouse monoclonal anti-HaloTag® (dilution 1:1,000; Promega; G9211) rabbit anti-tPA polyclonal antibody (dilution 1:1 500; generous gift from R. Lijnen, Leuven), chicken anti-Microtubule-associated protein 2 (MAP2) polyclonal antibody (dilution 1:8 000; Abcam, Cambridge, UK; ab5392), rabbit anti-tau polyclonal antibody (dilution 1:500; Abcam; ab64193), guinea pig anti-synapsin polyclonal antibody (dilution 1:500; Synaptic System; 106 004) and rabbit anti-homer-1C polyclonal antibody (dilution 1:500; Synaptic System; 160 003).

    Control:

    Article Title: High-content synaptic phenotyping in human cellular models reveals a role for BET proteins in synapse assembly
    Article Snippet: antibody , Anti-human HOMER (Rabbit polyclonal) , Synaptic Systems , Cat#160003 RRID: AB_887730 , WB (1:500).

    Article Title: High-content synaptic phenotyping in human cellular models reveals a role for BET proteins in synapse assembly
    Article Snippet: DOI: https://doi.org/10.7554/eLife.80168 19 of 31 Reagent type (species) or resource Designation Source or reference Identifiers Additional information antibody Anti- human SYNAPSIN1 (Rabbit polyclonal) Millipore Cat#AB1543 RRID: AB_2200400 IF (1:1000) WB (1:1000) antibody Anti- human MAP2 (Chicken polyclonal) Abcam Cat#ab5392 RRID: AB_2138153 IF (1:1000) antibody Anti- human SYNAPTOPHYSIN (Mouse monoclonal) Cell Signaling Technology Cat#9020 RRID: AB_2631095 IF (1:500) antibody Anti- human PSD95 (Mouse monoclonal) Thermo Fisher Scientific Cat#MA1- 046 RRID: AB_2092361 IF (1:500) antibody Anti- human GAPDH (Mouse monoclonal) Millipore Cat#MAB374 RRID: AB_2107445 WB (1:1000) antibody Anti- human HOMER (Rabbit polyclonal) Synaptic Systems Cat#160003 RRID: AB_887730 WB (1:500) antibody Anti- human BAIAP2 (Rabbit polyclonal) Thermo Fisher Scientific Cat#PA5- 30386 RRID: AB_2547860 WB (1:500) antibody Anti- human COFILIN Abcam Cat#ab42824 RRID: AB_879739 WB (1:1000) recombinant DNA reagent pAAVS1- iNGN2- Zeo (plasmid) This study sequence- based reagent Forward NGN2 This study PCR primers AGGAAATGGGGGTGTGTCAC sequence- based reagent Reverse NGN2 This study PCR primers GAGCTCCTCTGGCGATTCTC commercial assay or kit DNeasy Blood and tissue kit Qiagen Cat#695004 commercial assay or kit RLTplus Lysis buffer Qiagen Cat#1053393 commercial assay or kit RNeasy micro/mini kit Qiagen Cat#74034 chemical compound, drug Geneticin Life Technologies Cat#10131035 50 μg.mL–1 chemical compound, drug SB431542 Tocris Cat#1614 10 μM; 5 μM chemical compound, drug XAV939 Stemgent Cat#04–00046 2 μM; 1 μM chemical compound, drug LDN- 193189 Stemgent Cat#04–0074 100 nM; 50 nM chemical compound, drug Doxycycline hyclate SIgma Cat#D9891 2 μg.mL–1 chemical compound, drug Y27632 Stemgent Cat#04–0012 5 mM chemical compound, drug Zeocin Invitrogen Cat#46–059 1 μg.mL–1 chemical compound, drug BDNF R&D Systems Cat#248- BD/CF 10 ng.mL–1 chemical compound, drug CTNF R&D Systems Cat#257- NT- CF 10 ng.mL–1 chemical compound, drug GDNF R&D Systems Cat#212- GD/CF 10 ng.mL–1 chemical compound, drug Floxuridine Sigma- Aldrich Cat#F0503- 100MG 10 μg.mL–1 Continued on next page Continued Berryer et al. eLife 2023;12:e80168.

    Article Title: Post-synaptic Release of the Neuronal Tissue-Type Plasminogen Activator (tPA)
    Article Snippet: The following primary antibodies were used for immunocytochemistry: mouse monoclonal anti-HaloTag® (dilution 1:1,000; Promega; G9211) rabbit anti-tPA polyclonal antibody (dilution 1:1 500; generous gift from R. Lijnen, Leuven), chicken anti-Microtubule-associated protein 2 (MAP2) polyclonal antibody (dilution 1:8 000; Abcam, Cambridge, UK; ab5392), rabbit anti-tau polyclonal antibody (dilution 1:500; Abcam; ab64193), guinea pig anti-synapsin polyclonal antibody (dilution 1:500; Synaptic System; 106 004) and rabbit anti-homer-1C polyclonal antibody (dilution 1:500; Synaptic System; 160 003).

    Drug discovery:

    Article Title: High-content synaptic phenotyping in human cellular models reveals a role for BET proteins in synapse assembly
    Article Snippet: antibody , Anti-human HOMER (Rabbit polyclonal) , Synaptic Systems , Cat#160003 RRID: AB_887730 , WB (1:500).

    Article Title: High-content synaptic phenotyping in human cellular models reveals a role for BET proteins in synapse assembly
    Article Snippet: DOI: https://doi.org/10.7554/eLife.80168 19 of 31 Reagent type (species) or resource Designation Source or reference Identifiers Additional information antibody Anti- human SYNAPSIN1 (Rabbit polyclonal) Millipore Cat#AB1543 RRID: AB_2200400 IF (1:1000) WB (1:1000) antibody Anti- human MAP2 (Chicken polyclonal) Abcam Cat#ab5392 RRID: AB_2138153 IF (1:1000) antibody Anti- human SYNAPTOPHYSIN (Mouse monoclonal) Cell Signaling Technology Cat#9020 RRID: AB_2631095 IF (1:500) antibody Anti- human PSD95 (Mouse monoclonal) Thermo Fisher Scientific Cat#MA1- 046 RRID: AB_2092361 IF (1:500) antibody Anti- human GAPDH (Mouse monoclonal) Millipore Cat#MAB374 RRID: AB_2107445 WB (1:1000) antibody Anti- human HOMER (Rabbit polyclonal) Synaptic Systems Cat#160003 RRID: AB_887730 WB (1:500) antibody Anti- human BAIAP2 (Rabbit polyclonal) Thermo Fisher Scientific Cat#PA5- 30386 RRID: AB_2547860 WB (1:500) antibody Anti- human COFILIN Abcam Cat#ab42824 RRID: AB_879739 WB (1:1000) recombinant DNA reagent pAAVS1- iNGN2- Zeo (plasmid) This study sequence- based reagent Forward NGN2 This study PCR primers AGGAAATGGGGGTGTGTCAC sequence- based reagent Reverse NGN2 This study PCR primers GAGCTCCTCTGGCGATTCTC commercial assay or kit DNeasy Blood and tissue kit Qiagen Cat#695004 commercial assay or kit RLTplus Lysis buffer Qiagen Cat#1053393 commercial assay or kit RNeasy micro/mini kit Qiagen Cat#74034 chemical compound, drug Geneticin Life Technologies Cat#10131035 50 μg.mL–1 chemical compound, drug SB431542 Tocris Cat#1614 10 μM; 5 μM chemical compound, drug XAV939 Stemgent Cat#04–00046 2 μM; 1 μM chemical compound, drug LDN- 193189 Stemgent Cat#04–0074 100 nM; 50 nM chemical compound, drug Doxycycline hyclate SIgma Cat#D9891 2 μg.mL–1 chemical compound, drug Y27632 Stemgent Cat#04–0012 5 mM chemical compound, drug Zeocin Invitrogen Cat#46–059 1 μg.mL–1 chemical compound, drug BDNF R&D Systems Cat#248- BD/CF 10 ng.mL–1 chemical compound, drug CTNF R&D Systems Cat#257- NT- CF 10 ng.mL–1 chemical compound, drug GDNF R&D Systems Cat#212- GD/CF 10 ng.mL–1 chemical compound, drug Floxuridine Sigma- Aldrich Cat#F0503- 100MG 10 μg.mL–1 Continued on next page Continued Berryer et al. eLife 2023;12:e80168.

    Article Title: Post-synaptic Release of the Neuronal Tissue-Type Plasminogen Activator (tPA)
    Article Snippet: The following primary antibodies were used for immunocytochemistry: mouse monoclonal anti-HaloTag® (dilution 1:1,000; Promega; G9211) rabbit anti-tPA polyclonal antibody (dilution 1:1 500; generous gift from R. Lijnen, Leuven), chicken anti-Microtubule-associated protein 2 (MAP2) polyclonal antibody (dilution 1:8 000; Abcam, Cambridge, UK; ab5392), rabbit anti-tau polyclonal antibody (dilution 1:500; Abcam; ab64193), guinea pig anti-synapsin polyclonal antibody (dilution 1:500; Synaptic System; 106 004) and rabbit anti-homer-1C polyclonal antibody (dilution 1:500; Synaptic System; 160 003).

    Software:

    Article Title: High-content synaptic phenotyping in human cellular models reveals a role for BET proteins in synapse assembly
    Article Snippet: antibody , Anti-human HOMER (Rabbit polyclonal) , Synaptic Systems , Cat#160003 RRID: AB_887730 , WB (1:500).

    Article Title: High-content synaptic phenotyping in human cellular models reveals a role for BET proteins in synapse assembly
    Article Snippet: DOI: https://doi.org/10.7554/eLife.80168 19 of 31 Reagent type (species) or resource Designation Source or reference Identifiers Additional information antibody Anti- human SYNAPSIN1 (Rabbit polyclonal) Millipore Cat#AB1543 RRID: AB_2200400 IF (1:1000) WB (1:1000) antibody Anti- human MAP2 (Chicken polyclonal) Abcam Cat#ab5392 RRID: AB_2138153 IF (1:1000) antibody Anti- human SYNAPTOPHYSIN (Mouse monoclonal) Cell Signaling Technology Cat#9020 RRID: AB_2631095 IF (1:500) antibody Anti- human PSD95 (Mouse monoclonal) Thermo Fisher Scientific Cat#MA1- 046 RRID: AB_2092361 IF (1:500) antibody Anti- human GAPDH (Mouse monoclonal) Millipore Cat#MAB374 RRID: AB_2107445 WB (1:1000) antibody Anti- human HOMER (Rabbit polyclonal) Synaptic Systems Cat#160003 RRID: AB_887730 WB (1:500) antibody Anti- human BAIAP2 (Rabbit polyclonal) Thermo Fisher Scientific Cat#PA5- 30386 RRID: AB_2547860 WB (1:500) antibody Anti- human COFILIN Abcam Cat#ab42824 RRID: AB_879739 WB (1:1000) recombinant DNA reagent pAAVS1- iNGN2- Zeo (plasmid) This study sequence- based reagent Forward NGN2 This study PCR primers AGGAAATGGGGGTGTGTCAC sequence- based reagent Reverse NGN2 This study PCR primers GAGCTCCTCTGGCGATTCTC commercial assay or kit DNeasy Blood and tissue kit Qiagen Cat#695004 commercial assay or kit RLTplus Lysis buffer Qiagen Cat#1053393 commercial assay or kit RNeasy micro/mini kit Qiagen Cat#74034 chemical compound, drug Geneticin Life Technologies Cat#10131035 50 μg.mL–1 chemical compound, drug SB431542 Tocris Cat#1614 10 μM; 5 μM chemical compound, drug XAV939 Stemgent Cat#04–00046 2 μM; 1 μM chemical compound, drug LDN- 193189 Stemgent Cat#04–0074 100 nM; 50 nM chemical compound, drug Doxycycline hyclate SIgma Cat#D9891 2 μg.mL–1 chemical compound, drug Y27632 Stemgent Cat#04–0012 5 mM chemical compound, drug Zeocin Invitrogen Cat#46–059 1 μg.mL–1 chemical compound, drug BDNF R&D Systems Cat#248- BD/CF 10 ng.mL–1 chemical compound, drug CTNF R&D Systems Cat#257- NT- CF 10 ng.mL–1 chemical compound, drug GDNF R&D Systems Cat#212- GD/CF 10 ng.mL–1 chemical compound, drug Floxuridine Sigma- Aldrich Cat#F0503- 100MG 10 μg.mL–1 Continued on next page Continued Berryer et al. eLife 2023;12:e80168.

    Article Title: Post-synaptic Release of the Neuronal Tissue-Type Plasminogen Activator (tPA)
    Article Snippet: The following primary antibodies were used for immunocytochemistry: mouse monoclonal anti-HaloTag® (dilution 1:1,000; Promega; G9211) rabbit anti-tPA polyclonal antibody (dilution 1:1 500; generous gift from R. Lijnen, Leuven), chicken anti-Microtubule-associated protein 2 (MAP2) polyclonal antibody (dilution 1:8 000; Abcam, Cambridge, UK; ab5392), rabbit anti-tau polyclonal antibody (dilution 1:500; Abcam; ab64193), guinea pig anti-synapsin polyclonal antibody (dilution 1:500; Synaptic System; 106 004) and rabbit anti-homer-1C polyclonal antibody (dilution 1:500; Synaptic System; 160 003).



    Similar Products

    90
    Synaptic Systems antibody anti-human homer (rabbit polyclonal)

    Antibody Anti Human Homer (Rabbit Polyclonal), supplied by Synaptic Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/antibody+anti-human+homer+(rabbit+polyclonal)/anti++human+homer++rabbit+polyclonal+/pmc10121225-8-2-7
    Average 90 stars, based on 1 article reviews
    antibody anti-human homer (rabbit polyclonal) - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    Journal: eLife

    Article Title: High-content synaptic phenotyping in human cellular models reveals a role for BET proteins in synapse assembly

    doi: 10.7554/eLife.80168

    Figure Lengend Snippet:

    Article Snippet: antibody , Anti-human HOMER (Rabbit polyclonal) , Synaptic Systems , Cat#160003 RRID: AB_887730 , WB (1:500).

    Techniques: Transfection, Construct, Control, Recombinant, Plasmid Preparation, Sequencing, Lysis, Drug discovery, Software